View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_103 (Length: 211)
Name: NF12598_high_103
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 27161 - 27339
Alignment:
| Q |
17 |
acagagtgcagacatgaaaataaagaaaatagatgaaaattgtcatttcattttttcctagatacttaacaatcataatgtcaactttcttggatgacta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27161 |
acagagtgcagacatgaaaataaagaaaatagatgaaaattatcatttcattttttcctagatacttaacaatcataatgtcaacttttttggatgacta |
27260 |
T |
 |
| Q |
117 |
aattctgtttgcaggtttctataggtttcctgctgatgattttagaggccttctccgccagacaaatcatggttgatat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27261 |
aattctgtttgcaggtttctataggtttcctgctgatgattttagaggccttctccgccagacaaatcatggctgatat |
27339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University