View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_46 (Length: 351)
Name: NF12598_high_46
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 13 - 333
Target Start/End: Complemental strand, 22586416 - 22586095
Alignment:
| Q |
13 |
agaagaaacaa-gtattgcataacaaccacctcttcatatatctactccactctttcatatctcattagcctattatatctttacttcacctaaattcat |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22586416 |
agaagaaacaaagtattgcataacaaccacctcttcatatatctactccactctttcatatctcattagcctattatatctttacttcacctaaattcat |
22586317 |
T |
 |
| Q |
112 |
atttcaattatactattttctctttaaagcataataaatatgattgactcatccatgtcaaagacaatgatggagaaaataatgtcttctaattggtcag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22586316 |
atttcaattatactattttctctttaaagcctaataaatatgattgactcatccatgtcaaagacaatgatggagaaaataatgtcttctaattggtcag |
22586217 |
T |
 |
| Q |
212 |
agaatgatgaacttttaagagagcttttagttgatgagactcctcttcttatgttgccacatgagagagtatctgaagtagccaatttaagtcatgaatc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22586216 |
agaatgatgaacttttaagagagcttttagttgatgagtctcctcttcttatgttgccacatgagagagtatctgaagtagccaatttaagtcatgattc |
22586117 |
T |
 |
| Q |
312 |
ttcaaaagaccaagcttttaat |
333 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
22586116 |
ttcaaaagaccaagcttttaat |
22586095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University