View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_49 (Length: 345)
Name: NF12598_high_49
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 9e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 164 - 334
Target Start/End: Complemental strand, 11049857 - 11049687
Alignment:
| Q |
164 |
tctacatctcatgtatgcttctctacttcggttctttctccttcgacatcgttccgatcattagacaccgttctgctcctggctctgtttatcggagtcc |
263 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||| |||||||||||| | |||||| |||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
11049857 |
tctacatctcctgtgtgcttctctacttcagttcgttctccttcgacgttgttccgttcattaatcaccgttccgctcctggctctgtttatcgtagtcc |
11049758 |
T |
 |
| Q |
264 |
tcaactctatgctaaactgaaattcgatatggatgaagataattcttcagttgacgcggttcgtctttcat |
334 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11049757 |
tcaactctacgctaaactgaaattcgaaatggatgaagataattcttcagttgacgcggttcgtctttcat |
11049687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 22 - 99
Target Start/End: Complemental strand, 11049999 - 11049922
Alignment:
| Q |
22 |
ccactccgctcccctcgtctccgccacacccgctccaaaaccgttcctaaaccaactccccgaaccatcccccaacga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
11049999 |
ccactccgctcccctcgtctccgccacacccgctccaaaaccgctcctaaaccctctccccgaaccatcccccaacga |
11049922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 214 - 285
Target Start/End: Complemental strand, 32929554 - 32929483
Alignment:
| Q |
214 |
gttccgatcattagacaccgttctgctcctggctctgtttatcggagtcctcaactctatgctaaactgaaa |
285 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||| |||||||||||||||| || ||| |||| |||||| |
|
|
| T |
32929554 |
gttccgattattaaacaccgtcctgctcctggctcgctttatcggagtcctcagctttattctaatctgaaa |
32929483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University