View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_77 (Length: 251)
Name: NF12598_high_77
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 37505261 - 37505025
Alignment:
| Q |
11 |
cagagatcgtggaatttgatatgaaaggtgtgtggacatcattggaagaatgtcaaaaacttggtctcacgaaagccattggagccagcaacttctcaat |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505261 |
cagagattgtggaatttgatatgaaaggtgtgtggacatcattggaagaatgtcaaaaacttggtctcacgaaagccattggagccagcaacttctcaat |
37505162 |
T |
 |
| Q |
111 |
caagaagcttgaaaaattgctatcctttgcaaccatccctcctgctgtgaatcaagtaattaataatttataagatcatatattgaaattaatttaacta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505161 |
caagaagcttgaaaaattgctatcctttgcaaccatccctcctgctgtgaatcaagtaattaataatttataagatcatatattgaaattaatttaacta |
37505062 |
T |
 |
| Q |
211 |
ttttagttgatttcatgtttgttggtattaatcactt |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37505061 |
ttttagttgatttcatgtttgttggtattaatcactt |
37505025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University