View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_88 (Length: 239)
Name: NF12598_high_88
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_88 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 31614226 - 31614392
Alignment:
| Q |
1 |
taatttgttacatcatttacatgcatcacttatagttcaaatcttatactgagctatgtagcactgacacttcttattgaaagttgtgtctgacatgata |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
31614226 |
taatttgttacatcattcacatgcatcacttatagttcaaatcttatactgggctatgtagcactgacacttcttattgaaagttatgtctgacacgata |
31614325 |
T |
|
| Q |
101 |
gtaatacatgtgattatattcgattaatttatttttcaaagtattatgtataaatatgtcaatttca |
167 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31614326 |
gtaacacatgtgattatattcgattaatttatttttcaaagtattatgtataaatatgtcaatttca |
31614392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 35871176 - 35871232
Alignment:
| Q |
91 |
tgacatgatagtaatacatgtgattatattcgattaatttatttttcaaagtattat |
147 |
Q |
| |
|
|||||||||| || ||||||||||| |||| |||| ||||||||||||| |||||| |
|
|
| T |
35871176 |
tgacatgataccaacacatgtgattacattcaattactttatttttcaaattattat |
35871232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 147
Target Start/End: Original strand, 24445377 - 24445433
Alignment:
| Q |
91 |
tgacatgatagtaatacatgtgattatattcgattaatttatttttcaaagtattat |
147 |
Q |
| |
|
|||||||||| || ||||||||||| |||| |||| ||||||||||||| |||||| |
|
|
| T |
24445377 |
tgacatgataccaacacatgtgattacattcaattactttatttttcaaattattat |
24445433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University