View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_90 (Length: 236)
Name: NF12598_high_90
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_90 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 41013285 - 41013507
Alignment:
| Q |
1 |
atgttttttagtgccctatatctttttataggacttagcatcaatgtatatcctgtattattgaatcaaactttggtaataactcaatatgatgtgttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41013285 |
atgttttttagtgccctatatctttttataggacttagcatccatgtatatcatgtattattgaatcaaactttggtaataactctatatgatgtgttta |
41013384 |
T |
 |
| Q |
101 |
tagttctataatctctttgatgtgaatttgggacaataatgaagtgctctacaattgg-nnnnnnnnnnncttggtacattgtaccgaatttggtttcaa |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41013385 |
tagttatataatctctttgatgtgaatttgggacaataatgaagtgctctacaattggttttttttttttcttggtacattgtaccgaatttggtttcaa |
41013484 |
T |
 |
| Q |
200 |
gttcaactaataaaggcaaaagt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41013485 |
gttcaactaataaaggcaaaagt |
41013507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University