View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_91 (Length: 232)
Name: NF12598_high_91
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_91 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 215
Target Start/End: Complemental strand, 36892870 - 36892675
Alignment:
| Q |
20 |
ctggttttgaatgcttaatcattctcaaggtctcaacaataagaggttgcctgtatttgactgcaacaagcaatacattttcttttcttgaggtagtgtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36892870 |
ctggttttgaatgcttaatcattctcaaggtctcaacaataagaggttgcctgtatttgactgcaacaagcaatacattttcttttcttgaggtagtgtt |
36892771 |
T |
 |
| Q |
120 |
atgaatggcacttggtatttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtcatctttttcttgat |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36892770 |
atgaatggcacttggtacttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtcatctttttcttgat |
36892675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 38 - 201
Target Start/End: Complemental strand, 36881762 - 36881599
Alignment:
| Q |
38 |
tcattctcaaggtctcaacaataagaggttgcctgtatttgactgcaacaagcaatacattttcttttcttgaggtagtgttatgaatggcacttggtat |
137 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| || | || ||||||||| |||||||||||||||| |||||| | |||| ||||||||||||||| || |
|
|
| T |
36881762 |
tcattctcaatgtctcaacaataacgggttgtcttgacttcactgcaacatgcaatacattttctttccttgagtttgtgtcatgaatggcacttggaat |
36881663 |
T |
 |
| Q |
138 |
ttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtc |
201 |
Q |
| |
|
||| ||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36881662 |
tttgtctagaaattcgttaaccagttcaactattccatttttcgctgcaaccaaaaatggtgtc |
36881599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 69 - 199
Target Start/End: Complemental strand, 36901846 - 36901716
Alignment:
| Q |
69 |
cctgtatttgactgcaacaagcaatacattttcttttcttgaggtagtgttatgaatggcacttggtatttttattagaatttcgttaaccatttcaact |
168 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| |||||| |||| || | | |||| ||||| || ||||||||||| || ||||||||| | |
|
|
| T |
36901846 |
cctgtattctactgcaacaagcaatacattttgtttgcttgagttagtactacggagggcagttggtgcttcgattagaatttctttcaccatttcatat |
36901747 |
T |
 |
| Q |
169 |
attccattttttgctgcaaccaaaaatggtg |
199 |
Q |
| |
|
|| |||||| | ||||||||||||| ||||| |
|
|
| T |
36901746 |
atgccatttctagctgcaaccaaaattggtg |
36901716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University