View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_high_98 (Length: 220)
Name: NF12598_high_98
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_high_98 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 7578220 - 7578030
Alignment:
| Q |
16 |
gagagtgaacacaaaaaagaaggtctt---ggttcaaattagaccattcacatccggtgatctgtgctctctaaataatgcagtgttcttcatttttgag |
112 |
Q |
| |
|
|||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7578220 |
gagagttaacacaaaaaagtaggtcttcttggttcaaattagaccattcacatccggtgatctgtgctctctaaataatgcagtgttcttcatttttgag |
7578121 |
T |
 |
| Q |
113 |
tttctttagttaccttgctatataattttcatgcagaattttgtttataaggaaaagtagttggttaggttcgtctaggatacctgtaact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7578120 |
tttctttagttaccttgctatataattttcatgcagaattttgtttataaggaaaagtagttggttaggttcgtctaggatacttgtaact |
7578030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University