View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_103 (Length: 221)
Name: NF12598_low_103
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_103 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 38996499 - 38996695
Alignment:
| Q |
16 |
cagtgttgtacttccttcttttcctcttgtcacaatttatgcagcatcaaaagcgtaagtatctctataaatttgttctttttatttatcaaaatgcacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38996499 |
cagtgttgtacttccttcttttcctcttgtcacaatttatgcagcatcaaaagcgtaagtatctctataaatttgttctttttatttatcaaaatgcacc |
38996598 |
T |
|
| Q |
116 |
caaaatattctgatattaaagacattgttttaaaaaccggattggacggccgaaaattgggtggagcgacctaatggactggcaatgccagtgaacg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
38996599 |
caaaatattctgatattaaagacattgttttaaaaaccggattggacggccgaaaattgggtggagcgacctaatggactggcaatgctattgaacg |
38996695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 27 - 113
Target Start/End: Original strand, 39001141 - 39001227
Alignment:
| Q |
27 |
ttccttcttttcctcttgtcacaatttatgcagcatcaaaagcgtaag-tatctctataaatttgttctttttatttatcaaaatgca |
113 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||| ||||||||||||| | |||||||||| || | |||||||||||||||||||| |
|
|
| T |
39001141 |
ttccttcatatcctcttgtcacactttatgcagcttcaaaagcgtaagcaagctctataaatgtg-tgtttttatttatcaaaatgca |
39001227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University