View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_105 (Length: 220)
Name: NF12598_low_105
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_105 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 69 - 205
Target Start/End: Original strand, 45450086 - 45450222
Alignment:
| Q |
69 |
ttctccaacacataattgatcaacccagtccatggtcaagtgaatctaaaaggctagatatttatcccatgctggaaaaatggaaattaaggaagatctt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45450086 |
ttctccaacacataattgatcaacccagtccatggtcatgtgaatctagaaggctagatatttatcccatgctggaaaaatggaaattacggaagatctt |
45450185 |
T |
 |
| Q |
169 |
ttctaaaataatagaactacagtacacggcatctctg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45450186 |
ttctaaaataatagaactacagtacacggcatctctg |
45450222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 45450033 - 45450066
Alignment:
| Q |
19 |
gtccaagtatattactaatttgattatttcctac |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45450033 |
gtccaagtatattactaatttgattatttcctac |
45450066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University