View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12598_low_107 (Length: 215)

Name: NF12598_low_107
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12598_low_107
NF12598_low_107
[»] chr7 (2 HSPs)
chr7 (16-199)||(45047345-45047519)
chr7 (162-200)||(45043713-45043751)
[»] chr3 (1 HSPs)
chr3 (155-193)||(38345987-38346025)


Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 45047345 - 45047519
Alignment:
16 catagggacgttggtgtttcttatgttgccattgttcttgtccaggtagtgttaaaacactattggatctgtaaggattagacccgtgtccgcgactgtg 115  Q
    |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45047345 catagggacgttggtgtttcttatgttgcctttgttctagtccaggtagtgttaaaacactattggatctgtaaggattagacccgtgtccgcgactgtg 45047444  T
116 attgtgtcgacctccactacccccactgctgctaccaccgatatcggcagcaaggagttcagcgtgtttcccagcttttgttat 199  Q
    |||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45047445 attgtgtcgacct---------ccactgctgctaccaccgatatcggcagcaaggagttcagcgtgtttcccagcttttgttat 45047519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 45043713 - 45043751
Alignment:
162 gcagcaaggagttcagcgtgtttcccagcttttgttatt 200  Q
    ||||||| ||||||||| |||||||||||||||||||||    
45043713 gcagcaatgagttcagcatgtttcccagcttttgttatt 45043751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 38346025 - 38345987
Alignment:
155 gatatcggcagcaaggagttcagcgtgtttcccagcttt 193  Q
    ||||||||||||||  |||||||||||||||||||||||    
38346025 gatatcggcagcaataagttcagcgtgtttcccagcttt 38345987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University