View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_107 (Length: 215)
Name: NF12598_low_107
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_107 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 45047345 - 45047519
Alignment:
| Q |
16 |
catagggacgttggtgtttcttatgttgccattgttcttgtccaggtagtgttaaaacactattggatctgtaaggattagacccgtgtccgcgactgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45047345 |
catagggacgttggtgtttcttatgttgcctttgttctagtccaggtagtgttaaaacactattggatctgtaaggattagacccgtgtccgcgactgtg |
45047444 |
T |
 |
| Q |
116 |
attgtgtcgacctccactacccccactgctgctaccaccgatatcggcagcaaggagttcagcgtgtttcccagcttttgttat |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45047445 |
attgtgtcgacct---------ccactgctgctaccaccgatatcggcagcaaggagttcagcgtgtttcccagcttttgttat |
45047519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 200
Target Start/End: Original strand, 45043713 - 45043751
Alignment:
| Q |
162 |
gcagcaaggagttcagcgtgtttcccagcttttgttatt |
200 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
45043713 |
gcagcaatgagttcagcatgtttcccagcttttgttatt |
45043751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 193
Target Start/End: Complemental strand, 38346025 - 38345987
Alignment:
| Q |
155 |
gatatcggcagcaaggagttcagcgtgtttcccagcttt |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38346025 |
gatatcggcagcaataagttcagcgtgtttcccagcttt |
38345987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University