View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_110 (Length: 213)
Name: NF12598_low_110
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_110 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 43218775 - 43218987
Alignment:
| Q |
1 |
aatttcaaccgtagcagtattcgttgaagatgaagccttgtgtgtgtaactgatatctaaattgtagtcttgcccttaggtttaagtcccgcccttagtt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43218775 |
aatttcaaccatagcagtattcgttgaagatgaagccttgtgtgtgtaactgatatctaaatggtagtcttgcccttaggtttaagtcccgcccttagtt |
43218874 |
T |
|
| Q |
101 |
ttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgataagatgtattattattagtttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43218875 |
ttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgataagatgtattattattagtttgt |
43218974 |
T |
|
| Q |
201 |
gttacaaatctaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43218975 |
gttacaaatctaa |
43218987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 92 - 213
Target Start/End: Complemental strand, 43169495 - 43169374
Alignment:
| Q |
92 |
cccttagttttgtattaaatatatgatgtatttatgagcactggcatgtaaagattgcaaacattgtatcatacaaaaaagttgataagatgtattatta |
191 |
Q |
| |
|
||||||||||||||| ||||||||| | |||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
43169495 |
cccttagttttgtataaaatatatgcttaatttatgagcaccggcatgtaaagattgcaaacattgtattatacaaaaaagttgataagatatattatta |
43169396 |
T |
|
| Q |
192 |
ttagtttgtgttacaaatctaa |
213 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
43169395 |
ttagtttctgttacaaatctaa |
43169374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 43169555 - 43169504
Alignment:
| Q |
1 |
aatttcaaccgtagcagtattcgttgaagatgaagccttgtgtgtgtaactg |
52 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
43169555 |
aatttcaaccgtagcagtatccgttgaagatgaagtcttgtgtctgtaactg |
43169504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University