View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_76 (Length: 269)
Name: NF12598_low_76
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_76 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 47 - 253
Target Start/End: Complemental strand, 16760378 - 16760172
Alignment:
| Q |
47 |
ttaaagaaaatgttaccaatgaacatcaaatgcaacctgttcatggcacgatgacaaagctcattctttttagggtttggaagaagctatcagtaaatcc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16760378 |
ttaaagaaaatgttaccaatgaacatcaaatgcaacctggtcatggcacgatgacaaagctcattctttttagggtttggaagaagctatcagtaaatcc |
16760279 |
T |
 |
| Q |
147 |
taatctctatgcttcagttcttggcattgtatgggctctcatatcagctaggtattttgcgatactcttgcatcctaaacaattttacaactctctcaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16760278 |
taatctctatgcttcagttcttggcattgtatgggctctcatatcagctaggtattttgcgatactcttgcatcctaaacaattttacaactctctcaag |
16760179 |
T |
 |
| Q |
247 |
ctcaaat |
253 |
Q |
| |
|
||||||| |
|
|
| T |
16760178 |
ctcaaat |
16760172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University