View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_77 (Length: 266)
Name: NF12598_low_77
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_77 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 49424246 - 49423999
Alignment:
| Q |
1 |
taaccgatctagacacagagaattcatcaaaggaatttatgtaaattagttggaattatatttttaaagactactaaattactaatcataaactaaggga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49424246 |
taaccgatctagacacagagaattcatcaaaggaatttatgtaaattagttggaattatatttttaaagactactaaattactaatcataaactaaggga |
49424147 |
T |
 |
| Q |
101 |
atcatcatgaatagacttcaaatcaaaagatgaatctagcaaggctcgtggttctggtgcaacttggatggcgcttacggagacttccgttccatggtgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49424146 |
atcatcatgaatagacttcaaatcaaaagatgaatctagcaaggctcgtggttctggtgcaacttggatggcgcttacggagacttccgttccatggtgg |
49424047 |
T |
 |
| Q |
201 |
tttcatgaatggagtgattatccagattactaatgacaggtttgtatc |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49424046 |
tttcatgaatggagcgattatccagattactaatgacaggtttgtatc |
49423999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 131 - 248
Target Start/End: Original strand, 49416533 - 49416650
Alignment:
| Q |
131 |
tgaatctagcaaggctcgtggttctggtgcaacttggatggcgcttacggagacttccgttccatggtggtttcatgaatggagtgattatccagattac |
230 |
Q |
| |
|
||||||||| |||||| ||| | ||||||| |||||||| | ||||| |||||||||| | | ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49416533 |
tgaatctagtaaggctgatggatttggtgcagcttggatgacacttacagagacttccgcttcgtggtggtttcatgaacggagtgattatccagattac |
49416632 |
T |
 |
| Q |
231 |
taatgacaggtttgtatc |
248 |
Q |
| |
|
| ||| | ||||||||| |
|
|
| T |
49416633 |
cattgatacgtttgtatc |
49416650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 43362976 - 43363025
Alignment:
| Q |
189 |
gttccatggtggtttcatgaatggagtgat--tatccagattactaatga |
236 |
Q |
| |
|
||||||||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
43362976 |
gttccatggtggtttcatgaaagaagtgattatatccagattactaatga |
43363025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University