View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12598_low_82 (Length: 251)

Name: NF12598_low_82
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12598_low_82
NF12598_low_82
[»] chr3 (1 HSPs)
chr3 (11-247)||(37505025-37505261)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 11 - 247
Target Start/End: Complemental strand, 37505261 - 37505025
Alignment:
11 cagagatcgtggaatttgatatgaaaggtgtgtggacatcattggaagaatgtcaaaaacttggtctcacgaaagccattggagccagcaacttctcaat 110  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37505261 cagagattgtggaatttgatatgaaaggtgtgtggacatcattggaagaatgtcaaaaacttggtctcacgaaagccattggagccagcaacttctcaat 37505162  T
111 caagaagcttgaaaaattgctatcctttgcaaccatccctcctgctgtgaatcaagtaattaataatttataagatcatatattgaaattaatttaacta 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37505161 caagaagcttgaaaaattgctatcctttgcaaccatccctcctgctgtgaatcaagtaattaataatttataagatcatatattgaaattaatttaacta 37505062  T
211 ttttagttgatttcatgtttgttggtattaatcactt 247  Q
    |||||||||||||||||||||||||||||||||||||    
37505061 ttttagttgatttcatgtttgttggtattaatcactt 37505025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University