View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_84 (Length: 250)
Name: NF12598_low_84
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_84 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 120 - 250
Target Start/End: Complemental strand, 47162803 - 47162673
Alignment:
| Q |
120 |
ctcagtgtaaccaaaaagaaaacaaaagagactttaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47162803 |
ctcaatgtaaccaaaaagaaaacaaaagagacttaaacttgaatttgagcttaaaataggcataaaaggaaaggggaacgaaaacagtttttcttgaaga |
47162704 |
T |
 |
| Q |
220 |
gtcatgggagaagaacacaagacatagagat |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
47162703 |
gtcatgggagaagaacaaaagacatagagat |
47162673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University