View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_86 (Length: 250)
Name: NF12598_low_86
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_86 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 1240096 - 1240333
Alignment:
| Q |
1 |
tcatcaacgaaaaatagagcatagaaaaacaaacatgaacatagggcataggaaagcaaattttggtgtccaacaccgtatacgtatatggtatagatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240096 |
tcatcaacgaaaaatagagcatagaaaaacaaacatgaacatagggcataggaaagcaaattttggtgtccaacaccgtatacgtatatggtatagatac |
1240195 |
T |
 |
| Q |
101 |
aannnnnnnnnnnnnnnnnnnnnnncttggtctccaagtcacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacat |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240196 |
aattttgttttttaattagttttttcttggtctccaagtcacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacat |
1240295 |
T |
 |
| Q |
201 |
cactcattgtgaaaatcactctaaacaaatacagttca |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240296 |
cactcattgtgaaaatcactctaaacaaatacagttca |
1240333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 130 - 205
Target Start/End: Original strand, 10175205 - 10175280
Alignment:
| Q |
130 |
gtctccaagtcacatccatcgttataaatgtattattatattgtgtcaaattttagatgtttagataacatcactc |
205 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
10175205 |
gtctccaagtcacatccattgttataaatgtatttttatacggtgtcaaattttagatattcagataacatcactc |
10175280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 102
Target Start/End: Original strand, 10175126 - 10175175
Alignment:
| Q |
53 |
aaagcaaattttggtgtccaacaccgtatacgtatatggtatagatacaa |
102 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
10175126 |
aaagcaatttttggtgtccgacaccatatacatatatggtatagatacaa |
10175175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University