View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_88 (Length: 244)
Name: NF12598_low_88
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 194
Target Start/End: Complemental strand, 35019562 - 35019379
Alignment:
| Q |
11 |
gagagagaagaaggtggcgcatattgtaactggaagagattgtaatgagagtagtatattatttgtatccatggtggttagatgtgtcatatgtacttct |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
35019562 |
gagaaagaagaaggtggcgcatattgtaaccggaagagattgtaatgagagtagtatattatttgtatccatggtggtttgatatgtcatatgtacttct |
35019463 |
T |
|
| Q |
111 |
ctgtgtatagattttatcaacagagaaagtacaaactagaagggatgatgatagattgagttagttacaactatctaatatcac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35019462 |
ctgtgtatagattttatcaacagagaaagtacaaattagaagggatgatgatagattgagttagttacaaggatctaatatcac |
35019379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 21 - 146
Target Start/End: Complemental strand, 35029634 - 35029516
Alignment:
| Q |
21 |
aaggtggcgcatattgtaactggaagagattgtaatgagagtagtatattatttgtatccatggtggttagatgtgtcatatgtacttctctgtgtatag |
120 |
Q |
| |
|
||||||| ||||||||||| |||||| ||||| | ||||||||||||| ||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
35029634 |
aaggtggagcatattgtaagtggaagggattgcagtgagagtagtataatatttgtatccatagtg-------ttgtgatatgtacttctctgtgtatag |
35029542 |
T |
|
| Q |
121 |
attttatcaacagagaaagtacaaac |
146 |
Q |
| |
|
|||| | | |||||||||||||||| |
|
|
| T |
35029541 |
gttttgtgagcagagaaagtacaaac |
35029516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University