View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_89 (Length: 242)
Name: NF12598_low_89
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_89 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 1240023 - 1239797
Alignment:
| Q |
1 |
tcctttttccagattccaga--actatggtatgagagtcattagttattgtttatgtatagggtacacaaccattttggttcccgattatgtgaggtgtt |
98 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1240023 |
tcctttttccagattccagagaactatggtatgagagtcattagttattgtttatgtatagggtacacaaccattttggttcccgattatgtgaggtgtt |
1239924 |
T |
 |
| Q |
99 |
gtaatgtatcaaaattgcaaatacatcccgagtcataaatgtaatatatgtactaaattgaacaacaaattacacattcaatgactaaataaactgacaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1239923 |
gtaatgtatcaaaattgcaaatacatcccgagccataaatgtaatatatgtattaaattgaacaacaaattacacattcaatgactaaataaactgacaa |
1239824 |
T |
 |
| Q |
199 |
ctaatattagatttgaggaccaaagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1239823 |
ctaatattagatttgaggaccaaagtg |
1239797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 145
Target Start/End: Original strand, 1172706 - 1172749
Alignment:
| Q |
102 |
atgtatcaaaattgcaaatacatcccgagtcataaatgtaatat |
145 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
1172706 |
atgtatcaaatttgcaaatacatccctagtcagaaatgtaatat |
1172749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University