View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_90 (Length: 242)
Name: NF12598_low_90
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_90 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 6 - 242
Target Start/End: Original strand, 37872603 - 37872839
Alignment:
| Q |
6 |
agacacaagacaataacaatactaacaatttaaaaaacaaattaattgaaagtaaccactttgcgtgatgtcatgttggaccccaacacatgtcggacac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37872603 |
agacacaagacaataacaatactaacaatttaaaaaacaaattaattgaaagtaaccactttgcgtgatgtcatgttggaccccaacacatgtcggacac |
37872702 |
T |
 |
| Q |
106 |
ggaatacgcatagtgtcgtgattcaaagcatgcttcatcatctttgttagttcatattcattaatttctatcattcatacacaagcccttttgatgttag |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37872703 |
ggaatacgcatagtgttgtgattcaaagcatgcttcatcatctttgttagttcatattcagtaatttctatcattcatacacaagcccttttgatgttag |
37872802 |
T |
 |
| Q |
206 |
ctgtggaaaactccaattgttgtgcttaatcttttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37872803 |
ctgtggaaaactccaattgttgtgcttaatcttttct |
37872839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University