View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12598_low_92 (Length: 241)
Name: NF12598_low_92
Description: NF12598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12598_low_92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 24777061 - 24776839
Alignment:
| Q |
1 |
acaccgtcggagtttgatcctagttcaattgcatggtggaagaagggtgatccggtgccgtttctgttcctctcgttggcgttcgacatgatcaaggaag |
100 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||||||||||||| |
|
|
| T |
24777061 |
acaccgtcggagtttgatcatagctcggttgcatggtggaagaagggtgaaccggtgccgtttttgtttctctcgttggcgtttgacatgatcaaggaag |
24776962 |
T |
|
| Q |
101 |
agaaagggaggaatgcaatgtcggatattggttgtaatgttttgaggacagtgatgcatactacgcctggtgatttattaccagttgtgtatctattttc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24776961 |
agaaagggaggaatgcgatgtcggatattggttgtaatgtcttgaggacagtgatgcatactacgcctggtgatttattaccagttgtgtatctattttc |
24776862 |
T |
|
| Q |
201 |
aaacaggattgctccaccgtatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
24776861 |
aaacaggattgctccaccgtatc |
24776839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University