View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_24 (Length: 332)
Name: NF12599_high_24
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 214
Target Start/End: Complemental strand, 26532289 - 26532095
Alignment:
| Q |
17 |
aaggttacccccaaagacacactactatacattattatgtagctactaattttagacttaaagagacgttttgcttgatttcattcggtcacattgctgg |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26532289 |
aaggttacccccaaagacacacta---tacattattatgtagctactaattttagacttaaagagacgtttcgcttgatttcattcggtcacattgctgg |
26532193 |
T |
|
| Q |
117 |
caaaaatcgtcttcattattatgacattatttggagacaaacatgcaacattggatcctttattattcaatttaacattactatttaataccatttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26532192 |
caaaaatcgtcttcattattatgacaacatttggagacaaacatgcaacattggatcctttattattcaatttaacattactatttaataccatttca |
26532095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 47 - 214
Target Start/End: Complemental strand, 26529072 - 26528905
Alignment:
| Q |
47 |
attattatgtagctactaattttagacttaaagagacgttttgcttgatttcattcggtcacattgctggcaaaaatcgtcttcattattatgacattat |
146 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
26529072 |
attattatgtagctactaattttaaacttaaagaggcgttttgcatgatttcattaggtcacattgctggcaaaattcgtcttcattattatgacaacat |
26528973 |
T |
|
| Q |
147 |
ttggagacaaacatgcaacattggatcctttattattcaatttaacattactatttaataccatttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
26528972 |
ttggagacaaacatgcaacattggatccattattattcaatttaacattactatataacaccatttca |
26528905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 242 - 300
Target Start/End: Original strand, 34024754 - 34024812
Alignment:
| Q |
242 |
gggttagaacttgatcatacttaaaatattaggtgagatatggtattattttcatttgt |
300 |
Q |
| |
|
||||||||| |||||| ||||||||||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
34024754 |
gggttagaatttgatcttacttaaaatattagatgagatatggtatcattctcatttgt |
34024812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University