View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_28 (Length: 319)
Name: NF12599_high_28
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 108 - 309
Target Start/End: Original strand, 44273046 - 44273247
Alignment:
| Q |
108 |
ataaaacaattcatggttgtttattgcagctcatacacgagtttgcgctgatggtggtgccaaccgtgtgtatgatgaaatgcctcttttcttccctcac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44273046 |
ataaaacaattcatggttgtttattgcagctcatacacgagtttgcgctgatggtggtgccaaccgtgtgtatgatgaaatgcctcttttcttccctcac |
44273145 |
T |
|
| Q |
208 |
caaaatccttctcatgttcgtaccaggtacaacnnnnnnncttcccaattgtgcgctgttttccactagtttagttcttggctttatgtttccaactctg |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44273146 |
caaaatccttctcatgttcgtaccaggtacaactttttttcttcccaattgtgcactgttttccactagtttagttcttggctttatgtttccaactctg |
44273245 |
T |
|
| Q |
308 |
tg |
309 |
Q |
| |
|
|| |
|
|
| T |
44273246 |
tg |
44273247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 44272933 - 44273007
Alignment:
| Q |
1 |
cttcccaaattcgctcctttgctttgggaccacggtatttctttctgcacccccatcctttcaattcttaccctc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44272933 |
cttcccaaattcgctcctttgctttgggaccacggtatttctttctgcacccccatcctttcaattcttaccctc |
44273007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 248 - 309
Target Start/End: Original strand, 20188674 - 20188735
Alignment:
| Q |
248 |
cttcccaattgtgcgctgttttccactagtttagttcttggctttatgtttccaactctgtg |
309 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20188674 |
cttcccaattgtgcactgttttccactagtttagttcttggctttatgtttccaactctgtg |
20188735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University