View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_29 (Length: 315)
Name: NF12599_high_29
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 296
Target Start/End: Complemental strand, 19805732 - 19805448
Alignment:
| Q |
12 |
agcaaaggaagatcaatataaccatgaaacaaagtgcctatatgtattcccgtcaaacccaaaaccacaagtgttttgcagcagaagactgtaggcgcta |
111 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
19805732 |
agcaaaggaagatcaacagaaccatgaaacaaagtgcctatatgtattcccgtcaaacctagaaccacaagtgttttgcagcagaagacagtaggtgcta |
19805633 |
T |
 |
| Q |
112 |
aaggggcatgtatcgaaggtaaaaagtgtagctggagatccttgacatgacgttgttttgctgcttcgacccatttgtcgaagcagtcagcctcagtctc |
211 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19805632 |
aagggacgtgtatcgaaggtaaaaagtgtagctggagatccttgacacgacgttgttttgctgcttcgacccatttgtcgaagcagtcagcctcagtctc |
19805533 |
T |
 |
| Q |
212 |
caagaatttagaacaacttatgatcgtgagataaaaagagttgagagttaggttgtgagagtgtggggagaacataacagcatcc |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19805532 |
caagaatttagaacaacttatgatcgtgagataaaaagagttgagagttaggttgtgagagtgtggggagaacataacagcatcc |
19805448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University