View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_30 (Length: 314)
Name: NF12599_high_30
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 303
Target Start/End: Complemental strand, 37447149 - 37446851
Alignment:
| Q |
19 |
taagatgtaggagacccacacttaaggggggatatattgtttggttcaagtgtgagtttaatatcaaatgacttaaaggttttggaaggagacctctagt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37447149 |
taagatgtaggagacccacacttaaggggggatatattgtttggttcaagtgtgagtttaatatcaaatgacttaaaggttttggaaggagacctctagt |
37447050 |
T |
 |
| Q |
119 |
ggttctcaaccattactctcttgttactctaggcaatctcagactcacttgggtggcctgatagtgttggcttgggaccttcaa---------------g |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| | |
|
|
| T |
37447049 |
ggttctcaaccattactctcttgttactctaggcaatct-agactcacttgggtggtctgatagtgttggcttgggaccttcaagtgtgctccttcaagg |
37446951 |
T |
 |
| Q |
204 |
gtcttaggttcgacttttcccagtaccaattttgttgggttagtttgattacttnnnnnnnctaatagagctacttataataatataatagatgattcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37446950 |
gtcttaggttcgacttttcccagtaccaattttgttgggttagtttgattacttaaaaaaactaatagagctacttataataatagaatagatgattcat |
37446851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University