View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_36 (Length: 255)
Name: NF12599_high_36
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 55171620 - 55171863
Alignment:
| Q |
1 |
tgactggatcccattgaaccttctttgatccttcctcggtgaaaactttaagttgctcacctctgagaccaacctgcaaattaaattgaattatagtctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171620 |
tgactggatcccattgaaccttctttgatccttcctcggtgaaaactttaagttgctcacctctgagaccaacctgcaaattaaattgaattatagtctc |
55171719 |
T |
 |
| Q |
101 |
tcattgccttcacttgaatatatagtaacaatggatggcat--attgattattacccgatgaccccaaccgttcttagtgagttcaagttttcctttatt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171720 |
tcattgccttcacttgaatatatagtaacaatggatggcataaattgattattacccgatgaccccaaccgttcttagtgagttcaagttttcctttatt |
55171819 |
T |
 |
| Q |
199 |
gagaccaaggatggatatggacttgggtccggcgtacctatgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55171820 |
gagaccaaggatggatatggacttgggtccggcgtacctatgct |
55171863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University