View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_high_38 (Length: 249)
Name: NF12599_high_38
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_high_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 2757803 - 2758041
Alignment:
| Q |
1 |
aaaattgtgcaagcctaggcctaaggaatataactaaatggattttagcattggatattcttcattcaagttcaacatttt-ttacaacaaacgcgagaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
2757803 |
aaaattgtgcaagcctaggcctaaggaatataactatatggattttagcattggatattcttcattcaagttcaacatttttttacaacaaacgagagaa |
2757902 |
T |
 |
| Q |
100 |
ttagcggcaggaaatttggtttttagagctggttgtaaccagcgtcaatcctaacttccgatggttgaagaaatggcgcaaaatttgacgccgtt---nn |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2757903 |
ttagcggcaggaaatttggtttttagagctggttgtaaccagcgtcaatcctaacttccgatggttgaagaaatggcgcaaaatttgacgccgttaaaaa |
2758002 |
T |
 |
| Q |
197 |
nnnnnngtaacggttacacacaacggccggcatatgatt |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2758003 |
aaaaaagtaacggttacagacaacggccggcatatgatt |
2758041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University