View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12599_high_46 (Length: 238)

Name: NF12599_high_46
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12599_high_46
NF12599_high_46
[»] chr6 (2 HSPs)
chr6 (1-127)||(14949876-14950002)
chr6 (183-224)||(14949812-14949853)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 14950002 - 14949876
Alignment:
1 tatataacatgacaaaacaattgtctgaatctcgaaatatatatgggccaaggtttaatccatggtggggtccatagggaaaaaatatcaacataaaata 100  Q
    ||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
14950002 tatataacatgacgaaacaattgtccgaatctcgaaatatatacgggccaaggtttaatccatggtggggtccattgggaaaaaatatcaacataaaata 14949903  T
101 aggatttagttgatatgttttgactct 127  Q
    |||||||||||||||||||||||||||    
14949902 aggatttagttgatatgttttgactct 14949876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 14949853 - 14949812
Alignment:
183 tggtttagttgtgttggcttaaaattttggagtgtgcttttt 224  Q
    ||||||||||||||||||||||||||||||||| ||||||||    
14949853 tggtttagttgtgttggcttaaaattttggagtttgcttttt 14949812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University