View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_low_11 (Length: 553)
Name: NF12599_low_11
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_low_11 |
 | |
|
| [»] scaffold0003 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0003 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 147 - 543
Target Start/End: Original strand, 343183 - 343577
Alignment:
| Q |
147 |
tatttgcaggtcatagttcatttctcttcttattggtgtatgccttcgaacaaatcctttctttgaagaagaattatattggcatccccctatcaagatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
343183 |
tatttgcaggtcatagttcatttctcttcttattggtgtatgccttcgaacgaatcctttctttgaagaagaattatattggcatccccc-atcaagatg |
343281 |
T |
|
| Q |
247 |
tcgtcttccaatgacataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcattagtttttgacatat |
346 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
343282 |
tcgtcttccaatgccataagcccttgttttgaagttacgaaccgtctttccagtaagtacgtcgatttttaaagttactgtgcactagtttttgacatat |
343381 |
T |
|
| Q |
347 |
ggtttcagtttagctttaacctaggatttcagttctcacttgttacattgtactgatatctaattaggaatgcatcattttgcttctcaggaagctaagg |
446 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
343382 |
ggtttcagtttagcttcaacctaggatttcagttctcacttgttacattgtactgatatctaattagggatgcatcattttgcttctcaggaagctaagg |
343481 |
T |
|
| Q |
447 |
ttgcttacaccggggagaaccatctgcgccgagaatgtgaaaaatgggaaaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
543 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
343482 |
ttgcttacaccggggagaaccatctgcgccgagaaagtgaaaaatggg-aaaatgttgcttcctcgttatagtgatcatgtcagtttatgacctttg |
343577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 120 - 193
Target Start/End: Complemental strand, 31544545 - 31544470
Alignment:
| Q |
120 |
ataatagctctt--attttgtgcataaaatatttgcaggtcatagttcatttctcttcttattggtgtatgccttc |
193 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||| || |||||||| ||| |||||||||| ||||||| |
|
|
| T |
31544545 |
ataatagctcttttattttgttcataaaatatttgcaggttatggttcatttttctgcttattggtgcgtgccttc |
31544470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University