View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_low_51 (Length: 250)
Name: NF12599_low_51
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 37343654 - 37343893
Alignment:
| Q |
4 |
agggtgatatcaaggtaaataatttgggatatctctcacaactggcctactttaatagttgtttcttaattagataaacccaaaatatgatgaatcatga |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343654 |
agggtgatatcaaggtaaataatttgggatatctctcacaactggcctactttaatagttgtttcttaattagataaacccaaaatatgatgaatcatga |
37343753 |
T |
 |
| Q |
104 |
atagactagtga---gtttaacactgatttagtgttccataagtttgtatcccttaacagctaatcatg-cttatactgatttggtattccattaaatct |
199 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || |
|
|
| T |
37343754 |
atagactagtgagtcgtttaacactgatttagtgttccataagtttgtatcccttaacagctaatcatgccttatactgatttggtattccattaaacct |
37343853 |
T |
 |
| Q |
200 |
atattccatgggatggatccacctacatcctattgttctt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343854 |
atattccatgggatggatccacctacatcctattgttctt |
37343893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University