View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12599_low_52 (Length: 249)

Name: NF12599_low_52
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12599_low_52
NF12599_low_52
[»] chr6 (1 HSPs)
chr6 (1-235)||(2757803-2758041)


Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 2757803 - 2758041
Alignment:
1 aaaattgtgcaagcctaggcctaaggaatataactaaatggattttagcattggatattcttcattcaagttcaacatttt-ttacaacaaacgcgagaa 99  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
2757803 aaaattgtgcaagcctaggcctaaggaatataactatatggattttagcattggatattcttcattcaagttcaacatttttttacaacaaacgagagaa 2757902  T
100 ttagcggcaggaaatttggtttttagagctggttgtaaccagcgtcaatcctaacttccgatggttgaagaaatggcgcaaaatttgacgccgtt---nn 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         
2757903 ttagcggcaggaaatttggtttttagagctggttgtaaccagcgtcaatcctaacttccgatggttgaagaaatggcgcaaaatttgacgccgttaaaaa 2758002  T
197 nnnnnngtaacggttacacacaacggccggcatatgatt 235  Q
          |||||||||||| ||||||||||||||||||||    
2758003 aaaaaagtaacggttacagacaacggccggcatatgatt 2758041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University