View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_low_58 (Length: 240)
Name: NF12599_low_58
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 37343652 - 37343430
Alignment:
| Q |
4 |
cgctagacatgtagttatttctctatattatgcatcaaatctctgtacataatacttatcagaaataatattcaagttcagttttccatttagatacatt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343652 |
cgctagacatgtagttatttctctatattatgcatcaaatctctgtacataatacttatcagaaataatattcaagttcagttttccatttagatacatt |
37343553 |
T |
 |
| Q |
104 |
ttaactcatttacacaataacacggga--atgagaaaatttgattgtactttatattttatctaatcttgatttgactttttattcttctgacaggcata |
201 |
Q |
| |
|
||||||||||||||||||||||||| | | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37343552 |
ttaactcatttacacaataacacggaattaagagaatatttgattgtactttatattttatctaatcttgatttgactttttattcttctgacaggcata |
37343453 |
T |
 |
| Q |
202 |
ggatacacactcactccagattt |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37343452 |
ggatacacactcactccagattt |
37343430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University