View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_low_60 (Length: 239)
Name: NF12599_low_60
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 225
Target Start/End: Complemental strand, 37047370 - 37047149
Alignment:
| Q |
4 |
acataaggtggtgttacaggcacaactggtggtttagggacatagggtggtctcacaacaggtggtttagggacatatggtggtggtttcacaactgggg |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37047370 |
acataaggtggtgttacaggtacaactggtggtttaggaacatagggtggtctcacaacaggtggtttagggacatatggtggtggtttcacaactgggg |
37047271 |
T |
 |
| Q |
104 |
gttttggtacgtaaggtggatgtactattggaggtttaacaattggtggttttggaacataaggtggatgtggttttggaacatgtggtgggtgtactgc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37047270 |
gttttggtacgtaaggtggatgtactattggaggtttaacaattggtggttttggaacataaggtggatgtggttttggaacatgtggtgggtgtactgc |
37047171 |
T |
 |
| Q |
204 |
tgggggtttgggatgatgaggt |
225 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37047170 |
tgggggtttgggatgatgaggt |
37047149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 37047532 - 37047501
Alignment:
| Q |
1 |
tgcacataaggtggtgttacaggcacaactgg |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37047532 |
tgcacataaggtggtgttacaggcacaactgg |
37047501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University