View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12599_low_61 (Length: 238)
Name: NF12599_low_61
Description: NF12599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12599_low_61 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 14950002 - 14949876
Alignment:
| Q |
1 |
tatataacatgacaaaacaattgtctgaatctcgaaatatatatgggccaaggtttaatccatggtggggtccatagggaaaaaatatcaacataaaata |
100 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14950002 |
tatataacatgacgaaacaattgtccgaatctcgaaatatatacgggccaaggtttaatccatggtggggtccattgggaaaaaatatcaacataaaata |
14949903 |
T |
|
| Q |
101 |
aggatttagttgatatgttttgactct |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
14949902 |
aggatttagttgatatgttttgactct |
14949876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 183 - 224
Target Start/End: Complemental strand, 14949853 - 14949812
Alignment:
| Q |
183 |
tggtttagttgtgttggcttaaaattttggagtgtgcttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14949853 |
tggtttagttgtgttggcttaaaattttggagtttgcttttt |
14949812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University