View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_high_17 (Length: 314)
Name: NF1259_high_17
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 45243177 - 45243393
Alignment:
| Q |
16 |
aataatatgcagttatgttatttcgacatcaaaatacatacaccataatatatgat--------gtttatccctatctctcttattctttatcttctaga |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45243177 |
aataaaatgcagttatgttatttcgacatcaaaatacatacaccataaaatatgatacagatgtgtttatccctatctctcttattctttatcttctaga |
45243276 |
T |
 |
| Q |
108 |
acttacagatannnnnnnnnnnnnnnnnn---catgcaaaaaccaatggatactgtacctgatatcaaaattttgatgtccagacatcatttctcaatca |
204 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45243277 |
acttacagatatttttttttaaaaaaaaaaaacatgcaaaaaccaatggataca--acctgatatcaaaattttgatgtccagacatgatttctcaatca |
45243374 |
T |
 |
| Q |
205 |
aaaaagtttaggtaccgat |
223 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
45243375 |
aaaaagtttaagtaccgat |
45243393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 202
Target Start/End: Original strand, 45237442 - 45237480
Alignment:
| Q |
164 |
tgatatcaaaattttgatgtccagacatcatttctcaat |
202 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
45237442 |
tgatatcaaaactttgatgtccaaacatcatttctcaat |
45237480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 62
Target Start/End: Complemental strand, 8576885 - 8576845
Alignment:
| Q |
22 |
atgcagttatgttatttcgacatcaaaatacatacaccata |
62 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
8576885 |
atgcagttgtgttatttcaacatcaaaatacatacaccata |
8576845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University