View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_high_18 (Length: 313)
Name: NF1259_high_18
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 36 - 301
Target Start/End: Complemental strand, 10465358 - 10465093
Alignment:
| Q |
36 |
gtatgatgtgggatgcatttattggtcccggatatgtggacacctcgtgcttctcacgctgatattttttaagctcattcattaatttgagaacttgcca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465358 |
gtatgatgtgggatgcatttattggtcccggatatgtggacacctcgtgcttctcacgctgatattttttaagctcattcattaatttgagaacttgcca |
10465259 |
T |
 |
| Q |
136 |
ccaacatggtgaaaatggaatctctaggtgttgttctttctgtctatacatacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaa |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465258 |
ccaacatggtgaaaatggaatctctaggtgtggttctttctgtctatacatacgggtcactacagcaggaatttcccttttgtggcccccaagtcttaaa |
10465159 |
T |
 |
| Q |
236 |
tattattggttgggaatgtaaagaaatgtagggatagctaggttttgtattaaatttgaggagtat |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465158 |
tattattggttgggaatgtaaagaaatgtagggatagctaggttttgtattaaatttgaggagtat |
10465093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University