View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1259_high_21 (Length: 271)

Name: NF1259_high_21
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1259_high_21
NF1259_high_21
[»] chr4 (1 HSPs)
chr4 (33-253)||(43114394-43114617)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 33 - 253
Target Start/End: Complemental strand, 43114617 - 43114394
Alignment:
33 caattttagatgtcaccaatcaccataatctctaacatatactaggttacaacactattatgttcaaatgtgaccgattagatccacgttcactataaat 132  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||    
43114617 caattttagatgtcaccaatcaccataatctcaaacatatactaggttacaacactattatgttcaaatgtgaccgattaaatccacgttcactatgaat 43114518  T
133 agataaaatattagatatactatgataaacgactcatagttaaatgatgttttagcagagatattatgtttctttttcgtgttttgaagcattaat---c 229  Q
    |||||||||||| |||||||||||||||| ||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||        
43114517 agataaaatattggatatactatgataaatgactcatagttaagtgatattttagcatagatattatgtttctttttcgtgttttgaagcattaatttgt 43114418  T
230 tgttgctgtcaactctccacctat 253  Q
    ||||||||||||||||||||||||    
43114417 tgttgctgtcaactctccacctat 43114394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University