View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_high_26 (Length: 226)
Name: NF1259_high_26
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 39185182 - 39185000
Alignment:
| Q |
20 |
gggttgtttaagtttttgtgttactgtttggtggtgttgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggtt---tttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39185182 |
gggttgtttaagtttttgtgttactgtttggtggtgttgtcaccagctttccgacggccatacacggtgggtagtggtgctggttgcttggttttttttt |
39185083 |
T |
|
| Q |
117 |
ggcggttttgggtatatatcgacnnnnnnnctctgggtgtctcacatgctttcaggtttggtactggttttggtgatattgttg |
200 |
Q |
| |
|
| |||||| ||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
39185082 |
tgtggttttaggtatatatcgac-ttttttctctgggtgtctcacgtgctttcacgttcggtactggttttggtgattttgttg |
39185000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University