View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_high_28 (Length: 223)
Name: NF1259_high_28
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 15 - 89
Target Start/End: Complemental strand, 36935065 - 36934991
Alignment:
| Q |
15 |
cagagaaaatggagttggatttaacatcgaaaacagcagaaacattgtttgaaggagacggtggtagttttgttc |
89 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36935065 |
cagaaaaaatggagttggatttaacaccgaaaacagcagaaacattgtttgaaggagacggtggtagttttgttc |
36934991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University