View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_high_32 (Length: 212)
Name: NF1259_high_32
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_high_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 42167874 - 42168041
Alignment:
| Q |
22 |
catcatcagaagctgaatatcgtgtcttagcaactacaacttgtgaattgcaatggttattgtctcttcttaaggatatgaaagttctatccaccaagct |
121 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |
|
|
| T |
42167874 |
catcctcagaagctgaatatcgtgtcttggcaactacaacttgtgaattgcaatggttattgtctcttcttaaggatctgaaagttctatccaccaaact |
42167973 |
T |
|
| Q |
122 |
aacagtcttgtacggtgacaatcaaagtgctattcatatagatgctaaccatgtctttcatgaaataa |
189 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42167974 |
aacagtcttgtacagtgacaatcaaagtattattcatatagatgctaaccatgtctttcatgaaataa |
42168041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University