View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_11 (Length: 458)
Name: NF1259_low_11
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 98 - 415
Target Start/End: Original strand, 43799643 - 43799948
Alignment:
| Q |
98 |
agtttttgatcagttgttgtttggctttgtgaaagtgatgtggattgaattttgtttatgatatatgtgaacaaattattgtacattgaatcatgattca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799643 |
agtttttgatcagttgttgtttggctttgtgaaagtgatgtggattgaattttgtttatgatacatgtgaacaaattattgtacattgaatcatgattca |
43799742 |
T |
|
| Q |
198 |
tggattatgaatattttttgtagattgttctttcaaatttaatagagatttgaattaattgtcnnnnnnnnttaaagatatgaattaattcttgtaatga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
43799743 |
tggattatgaatattttttgtagattgttctttcaaatttaatagagatttgaattaattgtcaaaaaaaattaaagatatgaattaa-----------a |
43799831 |
T |
|
| Q |
298 |
ttatttggattttgtttaaatttttgtgtgaacaaagcatgcttgtatggcttggggataattattttttagccttatgaaatgtagttgcccgtttgtg |
397 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43799832 |
tt-tttggattttgtttaaatttttgtgtgaacaaagcatgcttgtatggcttggggataagtattttttagccttatgaaatgtagttgcccgtttgtg |
43799930 |
T |
|
| Q |
398 |
cggtgtttctttacaaat |
415 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
43799931 |
cagtgtttctttacaaat |
43799948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University