View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_12 (Length: 425)
Name: NF1259_low_12
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 44 - 332
Target Start/End: Original strand, 34350011 - 34350298
Alignment:
| Q |
44 |
ctccaagaaaatactaactagaaggtttagaattcaaaga-taatcaactcataaactaacattgttcaaaaagataagtacaataatttggtnnnnnnn |
142 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34350011 |
ctccaaaagaatactaactagaaggtttagaattcaaagaataatcaactcataaactaacattgttcaaaaagataagtacaataatttggtaaaaaag |
34350110 |
T |
|
| Q |
143 |
caaagtacagtaatagtgtaatacctttgaatgtgaatcaaaatttgaaggggagaattgaggttgcaaagaggggaagaaagtagacctaacatccttg |
242 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34350111 |
--aagtagagtaatagtgtaatacctttgaatgtgaatcaaaatttgaaggggaaaattgaggttgcaaagaggggaagaaagtagacctaacatccttg |
34350208 |
T |
|
| Q |
243 |
atagaattaggagcctcagaagcattccaaaaaggggtgttgttagtaaaatgcaactggttattagttggttgttttggaggtgaagtt |
332 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34350209 |
acggaattaggagcctcagaagcattccaaaaaggggtgttgttagtaaaatgcaactggttattggttggttgttttggaggtgaagtt |
34350298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University