View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_22 (Length: 351)
Name: NF1259_low_22
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 32 - 253
Target Start/End: Original strand, 9617651 - 9617872
Alignment:
| Q |
32 |
attaacctgtctgctcttagtgctctcttgatcttctcaacatgtggtattaaagttctggttcgacttgatggaggagaaaaagtggattattaataga |
131 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9617651 |
attaatctgtctgctcttagtgctctcttgatcttctcaacatgtggtattaaagttctggttcgacttgatggaggagaaaaagtgaattattaataga |
9617750 |
T |
|
| Q |
132 |
ttcaagtgtgaatgatagttccatatcagacgtgaatgagtccctcaatcctttaaaattttggatgaagatgtgatgtctaatctcttggcagttaaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9617751 |
ttcaagtgtgaatgatagttccatatcagtcgtgaatgagtccctcaatactttaaaattttggatgaagatgtgatgtctaatctcttggcggttaaag |
9617850 |
T |
|
| Q |
232 |
gagtttcatactgattatgact |
253 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
9617851 |
gagtttcatactgactatgact |
9617872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 288
Target Start/End: Original strand, 9617950 - 9617984
Alignment:
| Q |
254 |
ttgtgaatgagttcctcaacttttttataattttg |
288 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9617950 |
ttgtgaatgagttcctcaactttcttataattttg |
9617984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University