View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_24 (Length: 319)
Name: NF1259_low_24
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 195 - 319
Target Start/End: Original strand, 46524681 - 46524805
Alignment:
| Q |
195 |
gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctctgaattgctaacttttcaacacacagc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
46524681 |
gtagggttgacaatggacaagtttctttctactgaaggttaaaatccgatgggtttgcttccaactttagctcttaattgctaacttttcaacaaacagc |
46524780 |
T |
 |
| Q |
295 |
taggatttgttgtagggcagggtcc |
319 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
46524781 |
taggatttgttgtagggaagggtcc |
46524805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University