View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_28 (Length: 309)
Name: NF1259_low_28
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 88 - 237
Target Start/End: Original strand, 28984677 - 28984826
Alignment:
| Q |
88 |
cgtcataaatagaagctccattcagcagagcgccccaaactttagcagttggctcaaacggcatcttagaaatgaacttttccgcttctgagagctttcc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28984677 |
cgtcataaatagaagctccattcagcagagcgccccaaactttagcagttggctcaaacggcatcttagaaatgaacttttccgcttctgagagctttcc |
28984776 |
T |
 |
| Q |
188 |
agctcgactaagaacaccaaccatgcaggcatagtgctccaccacaggtt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28984777 |
agctcgactaagaacaccaaccatgcaggcatagtgctccaccacaggtt |
28984826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University