View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_30 (Length: 304)
Name: NF1259_low_30
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 85 - 190
Target Start/End: Complemental strand, 38582275 - 38582170
Alignment:
| Q |
85 |
actggaccaggttcaaatgttcaagcaagagttaagtggggaaagggtgttcttagcaaagctgatgcaactaaatatactgctgctcaatggattgaag |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38582275 |
actggaccaggttcaaatgttcaagcaagagttaagtggggaaagggtgttcttagcaaagctgatgcaactaaatatactgctgctcaatggattgaag |
38582176 |
T |
 |
| Q |
185 |
gtggtg |
190 |
Q |
| |
|
|||||| |
|
|
| T |
38582175 |
gtggtg |
38582170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University