View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_33 (Length: 280)
Name: NF1259_low_33
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 40 - 221
Target Start/End: Complemental strand, 43542088 - 43541907
Alignment:
| Q |
40 |
atgatgatgatgatagtaatatagctagtcttgcagccagaatccgaggctttcagaagcaggagtcaagagagatttctgagaatcttaccaaatctat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
43542088 |
atgatgatgatgatagtaatatagctagtcttgcagccagaatccgaggctttcagaagcaggagtcaagagagatttctgagaatctgatcaaatctat |
43541989 |
T |
 |
| Q |
140 |
tcattgtcatggatagcagccagaaggtagccctcatgagtaatcaaaacgctaaagatttattggccattgtactgtcatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43541988 |
tcattgtcatggatagcagccagaaggtagccctcatgagtaatcaaaacgctaaagatttattagccattgtactgtcatc |
43541907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University