View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_34 (Length: 278)
Name: NF1259_low_34
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 38 - 246
Target Start/End: Original strand, 22423589 - 22423797
Alignment:
| Q |
38 |
cagagaatgaaagttagtgcagttacataagaagagtgacagacaagaggttattcaagttgttgcaatagaatagtttagggctggagttattatctga |
137 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22423589 |
cagataatgaaagttagtgcagttacataggaagagtgacagacaagaggttattcaagttgttgcaatagaatagtttagggctggagttattatttga |
22423688 |
T |
 |
| Q |
138 |
acttgggagctctgccctttgtattccatttccacttaaatacataattacctatacaacaccgacacttcagattgaaggtgtgtttagtgtttgtatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22423689 |
acttgggagctctgccctttgtattccatttccacttaaatacataactacctatacaacaccgacacttcagattgaaggtgtgtttagtgtttgtatc |
22423788 |
T |
 |
| Q |
238 |
tgtggtgct |
246 |
Q |
| |
|
||||||||| |
|
|
| T |
22423789 |
tgtggtgct |
22423797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University