View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1259_low_35 (Length: 275)

Name: NF1259_low_35
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1259_low_35
NF1259_low_35
[»] chr8 (1 HSPs)
chr8 (32-244)||(16014022-16014234)
[»] scaffold0036 (1 HSPs)
scaffold0036 (109-229)||(64-184)


Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 244
Target Start/End: Complemental strand, 16014234 - 16014022
Alignment:
32 gagcacagaaacgcctgaacaattcccaaatcctgaatgactgatgcctaaaacatcattcagttccctaccattaattgtagaattggaatcaccgaca 131  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
16014234 gagcacagaaacacctgaacaattcccaaatcctgaatgactgatgcctaaaacatcattcaattccctaccattaaatgtagaattggaatcaccgaca 16014135  T
132 tttgcaaatacagggttctttagatttaccctgtctctaataaattcaaaagcgaattcctcacccgtttgtattgaataattctgtacagatttaacat 231  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16014134 tttgaaaatacagggttctttagatttaccctgtctctaataaattcaaaagcgaattcctcacccgtttgtattgaataattctgtacagatttaacat 16014035  T
232 ctgtggtgctgct 244  Q
    |||  ||||||||    
16014034 ctgatgtgctgct 16014022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 109 - 229
Target Start/End: Original strand, 64 - 184
Alignment:
109 ttgtagaattggaatcaccgacatttgcaaatacagggttctttagatttaccctgtctctaataaattcaaaagcgaattcctcacccgtttgtattga 208  Q
    ||||| |||| | ||||| |||||| | ||||||||| |||   | |||| |||| ||||| ||||| |||| || ||||||||||||||| ||||| ||    
64 ttgtataattaggatcactgacattcgaaaatacaggcttcccgatatttgccctatctctcataaactcaagagagaattcctcacccgtctgtatcga 163  T
209 ataattctgtacagatttaac 229  Q
     |||| |||||||| ||||||    
164 gtaatgctgtacaggtttaac 184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University