View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1259_low_37 (Length: 271)
Name: NF1259_low_37
Description: NF1259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1259_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 33 - 253
Target Start/End: Complemental strand, 43114617 - 43114394
Alignment:
| Q |
33 |
caattttagatgtcaccaatcaccataatctctaacatatactaggttacaacactattatgttcaaatgtgaccgattagatccacgttcactataaat |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
43114617 |
caattttagatgtcaccaatcaccataatctcaaacatatactaggttacaacactattatgttcaaatgtgaccgattaaatccacgttcactatgaat |
43114518 |
T |
|
| Q |
133 |
agataaaatattagatatactatgataaacgactcatagttaaatgatgttttagcagagatattatgtttctttttcgtgttttgaagcattaat---c |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43114517 |
agataaaatattggatatactatgataaatgactcatagttaagtgatattttagcatagatattatgtttctttttcgtgttttgaagcattaatttgt |
43114418 |
T |
|
| Q |
230 |
tgttgctgtcaactctccacctat |
253 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43114417 |
tgttgctgtcaactctccacctat |
43114394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University